At OReilly, weve long been supporters of the open source movement perhaps not with the religious fervor of some, but with a deep appreciation for how open source has transformed the computing industry over the last three decades.
We also have a deep appreciation for the dangers that closed source, restrictive licenses, patent trolling, and other technocratic evils pose to areas that are just opening up biology, in particular. So it is with great interest that I read Open Source Biotech Consumables in the latest issue of BioCoder.
Im not going to rehash the article; you should read it yourself. The basic argument is that some proteins used in research cost thousands of dollars per milligram. Theyre easily reproducible (were talking DNA, after all), but frequently tied up with restrictive licenses. In addition, many of the vendors will only sell to research institutions and large corporations, not home labs or small community labs. So, Joe Schloendorn is creating and distributing plasmids that can freely be reproduced. That in itself is a huge breakthrough.
His article started me wondering about the meaning of open source in biology specifically, open source DNA. I grew up with the computer industry, and I understand open source source code. I can download a tarball of C (or clone a GitHub archive), look at whats there, modify it, use the results. At some level, DNA is no different: Ive said that synthetic biology is programming in a language we dont yet understand; there is no DNA: The Definitive Guide. So, the superficial implementation of open source for DNA would be a long string of AATCGGGGGCCCCCAAAGAATGGC (what did I just say?), with an Apache License attached somewhere. Or GPL, or MIT; pick your flavor were not religious about it.
Insert the plasmids into some bacteria and brew up a batch of new DNA its simpler and faster than brewing beer.
While that might be where were headed, such an implementation isnt useful. I think there are a few labs that can synthesize DNA from a list of nucleotides, but thats a route that most small labs and home experimenters cant take.
What Schloendorn is doing is much more interesting: hes distributing the plasmids containing the gene of interest, and saying that youre free to reproduce it. Insert the plasmids into some bacteria and brew up a batch of new DNA. Its simple simpler and faster than brewing beer.
Where is the source code? In many respects, the source code is the DNA itself, not the series of ATCGs that represent it. Thats what we need to reproduce and modify, even if we dont know or understand it as well as we understand a tarball of C, Python, or Java.
But I still wonder: what does an open source license mean for this kind of source code? Whats the best way to protect DNA from patent trolling and other abuses? Having been involved with the computer industry all my life, code that you cant see makes me nervous. Shipping plasmids sounds, to me, like proprietary software you can download for free: free as in beer, not free as in liberty. But this clearly isnt about free as in beer; you are free to reproduce and modify the DNA.
Read this article:
Open source biology
- Howard H. Seliger, Hopkins biology professor [Last Updated On: January 1st, 2013] [Originally Added On: January 1st, 2013]
- General Biology-Concepts and Investigations - Video [Last Updated On: January 31st, 2013] [Originally Added On: January 31st, 2013]
- Biology Reproduction part 13 (Sexual reproduction: Flower Structure) CBSE class 10 X - Video [Last Updated On: January 9th, 2014] [Originally Added On: January 9th, 2014]
- How far can a Buddhist approach to biology take us? [Last Updated On: January 14th, 2014] [Originally Added On: January 14th, 2014]
- Biology revision song on protein synthesis by Andrew Perkins - Video [Last Updated On: January 30th, 2014] [Originally Added On: January 30th, 2014]
- Scientific Evidence for Creation CSE BIBLE FORUM Origins 1212 Dr Seuss Biology - Video [Last Updated On: February 9th, 2014] [Originally Added On: February 9th, 2014]
- Synthetic biology lab backed by 2 million award [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Vanguard High teacher wins 2014 Shell Science Lab Challenge [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Biohacking and the problem of bioterrorism [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Synthetic genetic clock keeps accurate time across a range of temperatures [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Math modeling integral to synthetic biology research [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Vacancies in biology dept. impact course options [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Dr. Joshua Reece Earns Best Presentation Award At Conference [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Life Science Reference - Biology Online [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- 9th Grade Biology: A Hectic Introduction to Mammals - Video [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Theism vs Evolution, Biology, and History - Video [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- AP Biology Ch.49 Circulatory System Livestream - Video [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- AP Biology Review Cards - Video [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- AP Biology - Chapter 49 Circulatory System Part 1 - Video [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- MSc Biology and PhD Boreal Ecology - Video [Last Updated On: April 9th, 2014] [Originally Added On: April 9th, 2014]
- Whale tales: Students set sail for biology class research [Last Updated On: April 10th, 2014] [Originally Added On: April 10th, 2014]
- Barnard biology professor honored with Emily Gregory award for teaching [Last Updated On: April 10th, 2014] [Originally Added On: April 10th, 2014]
- biology: Definition from Answers.com - Answers - The Most ... [Last Updated On: April 10th, 2014] [Originally Added On: April 10th, 2014]
- Biology - Wikipedia, the free encyclopedia [Last Updated On: April 10th, 2014] [Originally Added On: April 10th, 2014]
- Bridging the Brain Disease Knowledge Gap through Computational Modeling and Systems Biology: An O... - Video [Last Updated On: April 10th, 2014] [Originally Added On: April 10th, 2014]
- Sharpening microscope images: New technique takes cues from astronomy, ophthalmology [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- COLLEGE NEWS: April 13 [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Eureka Once, Eureka Twice [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Biology [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- The Art of Nutrients - Biology Song - 'Counting Stars' Remake - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Biology - The Nervous System - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- OCR AS BIOLOGY: - Cell Structures - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Evolutionary Biology Research / F. Robin O'Keefe and Julie Meachen / Page Museum - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- What Is a Thyroid In Biology? : Let's Get Medical - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Red Ice Radio - Sofia Smallstorm - Hour 1 - Chemtrails to Pseudo-Life & Synthetic Biology - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- STARNES: Did professor advocate censorship of conservative student newspaper? [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- German Research Foundation approves new priority program in the life sciences [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Announcing BioCoder issue 3 [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Poetry by Linda Bierds, Buddhism and biology [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Digestion - Biology Music Video - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- AS Level Biology- Edexcel/SNAB- Unit 1 Revision Notes - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- The Anatomy Of The Heart - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- #OilerNation Biology Program Q & A Hangout - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Northwestern University researchers on synthetic biology - Video [Last Updated On: April 15th, 2014] [Originally Added On: April 15th, 2014]
- Gregor Mendel Institute of Molecular Plant Biology (Vienna) - Video [Last Updated On: April 16th, 2014] [Originally Added On: April 16th, 2014]
- Biology 1B - 2014-04-14 - Video [Last Updated On: April 16th, 2014] [Originally Added On: April 16th, 2014]
- AP Biology Review 3/7: Cell Energy - Video [Last Updated On: April 16th, 2014] [Originally Added On: April 16th, 2014]
- MCB 410: Developmental Biology - Video [Last Updated On: April 16th, 2014] [Originally Added On: April 16th, 2014]
- Dyslexic Advantage - UCSF Symposium - Dr Fumiko Hoeft - Biology of Stealth Dyslexia - Video [Last Updated On: April 16th, 2014] [Originally Added On: April 16th, 2014]
- Life cycle of Silkworm- Insect Molecular Biology Lab, Dr.M.Krishnan, Bharathithasan University. - Video [Last Updated On: April 16th, 2014] [Originally Added On: April 16th, 2014]
- Tracking flu levels with Wikipedia [Last Updated On: April 17th, 2014] [Originally Added On: April 17th, 2014]
- Biology major Katharine Leigh '15 wins Udall scholarship [Last Updated On: April 17th, 2014] [Originally Added On: April 17th, 2014]
- First in the nation: UW-Madison establishes post-doc in feminist biology [Last Updated On: April 17th, 2014] [Originally Added On: April 17th, 2014]
- Biology Project: Predation - Video [Last Updated On: April 17th, 2014] [Originally Added On: April 17th, 2014]
- Report Focussing On Biology Underlining - Video [Last Updated On: April 17th, 2014] [Originally Added On: April 17th, 2014]
- edX | MITx: Quantitative Biology Workshop: 7QBWx About Video - Video [Last Updated On: April 17th, 2014] [Originally Added On: April 17th, 2014]
- Cell Mediated Response (Erdmann's 2B-3 AP Biology) - Video [Last Updated On: April 17th, 2014] [Originally Added On: April 17th, 2014]
- Biology Plantae part 13 (Mosses: structure, life cycle, mosses vs leafy liverwots) CBSE class 11 XI - Video [Last Updated On: April 17th, 2014] [Originally Added On: April 17th, 2014]
- Biology - Photosynthesis - Video [Last Updated On: April 19th, 2014] [Originally Added On: April 19th, 2014]
- The Genie in Your Genes: Epigenetics and Biology of Intention - Video [Last Updated On: April 19th, 2014] [Originally Added On: April 19th, 2014]
- Introduction to Synthetic Biology Andrew Hessel - Video [Last Updated On: April 19th, 2014] [Originally Added On: April 19th, 2014]
- Teacher of Biology [Last Updated On: April 21st, 2014] [Originally Added On: April 21st, 2014]
- Biology - Osmosis - Video [Last Updated On: April 21st, 2014] [Originally Added On: April 21st, 2014]
- UW to host first feminist biology post-doc program in nation [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- The Biology Project: Cell Biology - University of Arizona [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- The Biology Corner [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- Rader's BIOLOGY 4 KIDS.COM - Biology basics for everyone! [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- Stanford CF Education Day 2014 Understanding the Biology - Video [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- 9th Grade Biology: Hectic Introduction to the Human Organ Systems pt.1 - Video [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- Honors Biology and Biology Mrs. Ellis - Video [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- Biology professor researches parasites [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- TRANSCRIPTION-Biology - Video [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- 2014 Interdisciplinary Innovation Forum: "Mathematical Biology" - Video [Last Updated On: April 22nd, 2014] [Originally Added On: April 22nd, 2014]
- This Week in Genome Biology [Last Updated On: April 24th, 2014] [Originally Added On: April 24th, 2014]
- Biology - Calvin Cycle - Video [Last Updated On: April 24th, 2014] [Originally Added On: April 24th, 2014]
- Systems biology course 2014 Uri Alon - lecture 3: FFL and more - Video [Last Updated On: April 24th, 2014] [Originally Added On: April 24th, 2014]
- Systems biology course 2014 Uri Alon - lecture 2: Auto regulation - Video [Last Updated On: April 24th, 2014] [Originally Added On: April 24th, 2014]
- Systems biology course 2014 Uri Alon - lecture 1: Basic concepts - Video [Last Updated On: April 24th, 2014] [Originally Added On: April 24th, 2014]
- 9th Grade Biology: Hectic Introduction to the Human Organ Systems pt.2 - Video [Last Updated On: April 24th, 2014] [Originally Added On: April 24th, 2014]
- Have Atheists Hijacked Biology? - Video [Last Updated On: April 24th, 2014] [Originally Added On: April 24th, 2014]