Open source biology

At OReilly, weve long been supporters of the open source movement perhaps not with the religious fervor of some, but with a deep appreciation for how open source has transformed the computing industry over the last three decades.

We also have a deep appreciation for the dangers that closed source, restrictive licenses, patent trolling, and other technocratic evils pose to areas that are just opening up biology, in particular. So it is with great interest that I read Open Source Biotech Consumables in the latest issue of BioCoder.

Im not going to rehash the article; you should read it yourself. The basic argument is that some proteins used in research cost thousands of dollars per milligram. Theyre easily reproducible (were talking DNA, after all), but frequently tied up with restrictive licenses. In addition, many of the vendors will only sell to research institutions and large corporations, not home labs or small community labs. So, Joe Schloendorn is creating and distributing plasmids that can freely be reproduced. That in itself is a huge breakthrough.

His article started me wondering about the meaning of open source in biology specifically, open source DNA. I grew up with the computer industry, and I understand open source source code. I can download a tarball of C (or clone a GitHub archive), look at whats there, modify it, use the results. At some level, DNA is no different: Ive said that synthetic biology is programming in a language we dont yet understand; there is no DNA: The Definitive Guide. So, the superficial implementation of open source for DNA would be a long string of AATCGGGGGCCCCCAAAGAATGGC (what did I just say?), with an Apache License attached somewhere. Or GPL, or MIT; pick your flavor were not religious about it.

Insert the plasmids into some bacteria and brew up a batch of new DNA its simpler and faster than brewing beer.

While that might be where were headed, such an implementation isnt useful. I think there are a few labs that can synthesize DNA from a list of nucleotides, but thats a route that most small labs and home experimenters cant take.

What Schloendorn is doing is much more interesting: hes distributing the plasmids containing the gene of interest, and saying that youre free to reproduce it. Insert the plasmids into some bacteria and brew up a batch of new DNA. Its simple simpler and faster than brewing beer.

Where is the source code? In many respects, the source code is the DNA itself, not the series of ATCGs that represent it. Thats what we need to reproduce and modify, even if we dont know or understand it as well as we understand a tarball of C, Python, or Java.

But I still wonder: what does an open source license mean for this kind of source code? Whats the best way to protect DNA from patent trolling and other abuses? Having been involved with the computer industry all my life, code that you cant see makes me nervous. Shipping plasmids sounds, to me, like proprietary software you can download for free: free as in beer, not free as in liberty. But this clearly isnt about free as in beer; you are free to reproduce and modify the DNA.

Read this article:
Open source biology