Stem Cell Research & Therapy – stemcellres.biomedcentral.com

Stem Cell Research & Therapy20156:260

DOI: 10.1186/s13287-015-0263-2

Reppel et al.2015

Received: 12May2015

Accepted: 8December2015

Published: 30December2015

Due to their intrinsic properties, stem cells are promising tools for new developments in tissue engineering and particularly for cartilage tissue regeneration. Although mesenchymal stromal/stem cells from bone marrow (BM-MSC) have long been the most used stem cell source in cartilage tissue engineering, they have certain limits. Thanks to their properties such as low immunogenicity and particularly chondrogenic differentiation potential, mesenchymal stromal/stem cells from Whartons jelly (WJ-MSC) promise to be an interesting source of MSC for cartilage tissue engineering.

In this study, we propose to evaluate chondrogenic potential of WJ-MSC embedded in alginate/hyaluronic acid hydrogel over 28days. Hydrogels were constructed by the original spraying method. Our main objective was to evaluate chondrogenic differentiation of WJ-MSC on three-dimensional scaffolds, without adding growth factors, at transcript and protein levels. We compared the results to those obtained from standard BM-MSC.

After 3days of culture, WJ-MSC seemed to be adapted to their new three-dimensional environment without any detectable damage. From day 14 and up to 28days, the proportion of WJ-MSC CD73+, CD90+, CD105+ and CD166+ decreased significantly compared to monolayer marker expression. Moreover, WJ-MSC and BM-MSC showed different phenotype profiles. After 28days of scaffold culture, our results showed strong upregulation of cartilage-specific transcript expression. WJ-MSC exhibited greater type II collagen synthesis than BM-MSC at both transcript and protein levels. Furthermore, our work highlighted a relevant result showing that WJ-MSC expressed Runx2 and type X collagen at lower levels than BM-MSC.

Once seeded in the hydrogel scaffold, WJ-MSC and BM-MSC have different profiles of chondrogenic differentiation at both the phenotypic level and matrix synthesis. After 4weeks, WJ-MSC, embedded in a three-dimensional environment, were able to adapt to their environment and express specific cartilage-related genes and matrix proteins. Today, WJ-MSC represent a real alternative source of stem cells for cartilage tissue engineering.

Once damaged, cartilage tissue has limited self-repair capacity. Today, traumatic and degenerative articular cartilage damage can only be treated symptomatically (analgesics and anti-inflammatory drugs) or by surgery (mosaicoplasty, microfracture, autologous chondrocyte implantation) in order to delay joint replacement. However, these methods fail to restore native tissue integrity and lead to the formation of fibrocartilage [1] which is functionally inferior to hyaline cartilage. For these reasons, scientists and clinicians consider cartilage tissue engineering to be a potential alternative treatment for cartilage repair. Tissue engineering uses three basic elements: a suitable cell source, a biocompatible scaffold and environmental factors [2] to produce in vitro or in situ neotissue. These three elements can be combined or used separately to repair cartilage defect. Several investigators preferred transplantation of cells only combined with scaffold to create functional tissue replacement in situ [3]. Three-dimensional (3D) scaffolds must be able to mimic the physiological environment and ensure attachment, proliferation and differentiation of cells. Due to their intrinsic properties, stem cells are promising tools for new tissue engineering developments and particularly for cartilage tissue regeneration. Owing to ethical considerations and the random efficiency of chondrogenic differentiation [4], the use of embryonic stem cells is not the most appropriate. Thus, mesenchymal stromal/stem cells (MSC) are an attractive source of cells for cartilage tissue engineering.

MSC from bone marrow (BM-MSC) remain the most studied stem cell source used in cartilage tissue engineering [5, 6]. However, bone marrow collection is a painful and invasive procedure with the possibility of donor site damage. In addition, it has been demonstrated that the number of available BM-MSC is quite low in this compartment [7], and their differentiation potential and proliferation capacity decrease with age [8, 9]. Consequently, the use of autologous BM-MSC for tissue repair, which in some indications concerns elderly patients, has certain limits. Thus, identifying alternative sources of MSC would be very helpful.

Due to their properties such as low immunogenicity [10] and, particularly, chondrogenic differentiation potential [11], MSC from the connective tissue of umbilical cord named Whartons jelly (WJ-MSC) promise to be an interesting source of MSC for cartilage tissue engineering [12]. Several studies have already demonstrated the potential of WJ-MSC for chondrogenic differentiation in 3D cultures. WJ-MSC were embedded in natural scaffolds such as type I collagen hydrogel [13] or in synthetic polymer scaffolds such as polyglycolic acid meshes [14], and polyvinyl alcohol-polycaprolactone [15]. Cells were cultivated for 3 to 4weeks in chondrogenic medium supplemented with growth factors (such as transforming growth factor (TGF)-1 and TGF-3 and bone morphogenic protein (BMP)2) used alone or in combination [15]. These works showed the successful chondrogenic induction of WJ-MSC in 3D scaffolds with expression of specific cartilage-related genes and matrix proteins (Sox9, aggrecan, type II collagen, and cartilage oligomeric matrix protein (COMP)).

Alginate hydrogel is an in vitro and in vivo biocompatible scaffold [16], and a hydrophilic polymer network which creates a porous microstructure ensuring nutrient diffusion, cell to cell contact, cell proliferation and differentiation [17]. Various studies have already shown that MSC embedded in alginate hydrogel represent a relevant model for chondrogenesis of human MSC and study of the molecular mechanisms involved in chondrogenic differentiation [6, 17]. Hyluronic acid (HA) is a natural component of native cartilage and HA hydrogel can support and promote the chondrogenic differentiation of MSC [18]. According to a recent in vivo study, HA is an attractive hydrogel candidate for cartilage tissue engineering [19].

In this study, we propose to evaluate chondrogenic potential of WJ-MSC embedded in alginate/hyaluronic acid (Alg/HA) hydrogel. Hydrogels were constructed by an original spraying method which has been previously described [6, 20]. Our main objective is to evaluate chondrogenic differentiation of WJ-MSC in a 3D scaffold, without adding growth factors, at transcript and protein levels. To conclude whether WJ-MSC represent a real alternative source of stem cells for cartilage tissue engineering, we compared the results to those obtained from standard BM-MSC.

WJ-MSC and BM-MSC were isolated and cultivated as previously described [12]. Human umbilical cords and bone marrow were collected after patients informed consent; this complied with national legislation regarding human sample collection, manipulation and personal data protection. These biological sa
mples were regarded as surgical waste and therefore, following the opinion of an ethics committee of Nancy Hospital, no authorization of this committee was necessary for their collection. BM-MSC were only used as a standard control.

Umbilical cord samples, from three donors, were rinsed with 70% ethanol and Hanks balanced salt solution (HBSS). To perform MSC isolation, the umbilical cord vessels were removed and Whartons jelly aseptically cut into small pieces (2 to 3mm3) which were plated in a six-well plate with complete medium (minimal Eagle medium (-MEM; Lonza, Walkersville, MD, USA) with 10% fetal bovine serum, glutamine 2mM, penicillin 100IU/mL, streptomycin 100g/mL and amphotericin B 2.5g/mL). They were incubated at 37C under a humidified atmosphere with 5% CO2 in normoxia. After 7days of contact with the plastic surface the cells migrated and, as enough adherent cells were obtained, the pieces were removed, the medium replaced and cultures continued until cell subconfluence (8090%). After 2weeks, WJ-MSC were harvested with 0.25% Trypsin-EDTA (Sigma-Aldrich, St. Louis, MO, USA) and grown up to passage (P)3.

Bone marrow samples from five donors aged from 25 to 60years were aspirated and diluted in HBSS. Nuclear cells were counted and the cell suspension was seeded at 50,000 nuclear cells/cm2 with complete medium. They were incubated at 37C under a humidified atmosphere with 5% CO2 in normoxia. BM-MSC migrated, adhered to the plastic surface and were cultivated up to subconfluence (P0). After 2 to 3weeks, cells were harvested with Trypsin-EDTA, seeded with complete medium at 1000 cells/cm2 and grown up to P3.

After expansion, at the end of the third passage, WJ-MSC and BM-MSC were harvested with Trypsin-EDTA and seeded at 310

cells/mL of Alg/HA hydrogel (Fig.

). Scaffolds were built up with one hydrogel layer seeded with MSC. Hydrogel was composed of 1.5% (m/v) Alg (medium viscosity, Sigma, France) and HA (Accros, France) (ratio 4:1) dissolved in 0.9% NaCl. The spraying method used was previously described with rat chondrocytes [

] and human MSC [

]. The spraying system consisted of an airbrush working with a compressor to induce spraying, with pressure being equal to 0.9bar. The spraying bottle containing the homogenized cellular suspension in Alg/HA hydrogel was connected to the airbrush, and then solution was sprayed on a sterile glass plate. After hydrogel gelation in a CaCl

bath at 102mM for 10minutes, cylinders were cut at 5mm diameter and 2mm thickness with a biopsy punch (Fig.

).

Illustration of protocol steps used to perform scaffold construct and chondrogenic differentiation. After monolayer expansion, MSC were seeded at 3 106 cells/mL of Alg/HA hydrogel. Hydrogel was sprayed, gelated, and cut into 5mm diameter cylinders; scale bar=5mm. Scaffolds were cultivated in a 48-well plate in differentiation medium for 28days. Alg/HA alginate/hyaluronic acid, MSC mesenchymal stromal/stem cells, P3 passage 3

For viability analysis, WJ-MSC were also seeded in Alg/HA hydrogel beads, manufactured as previously described [21], by simple encapsulation without spraying and used as a control.

Scaffolds were cultivated in a 48-well plate in differentiation medium containing DMEM-high glucose (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Gibco), glutamine 2mM (Sigma), penicillin 100 U/mL (Sigma), streptomycin 100g/mL (Sigma), amphotericin B 2.5g/mL (Sigma), 100g/mL sodium pyruvate (Sigma), 40g/mLL-Proline (Sigma), 50g/mLL-acid ascorbic (Sigma), 100 nM dexamethasone (Sigma) and 1mM CaCl2 (Sigma). Scaffolds were incubated at 37C under a humidified atmosphere with 5% CO2 in normoxia for 28days and differentiation medium was changed twice a week (Fig.1).

During chondrogenic differentiation, after 3, 14 and 28days of culture, cells were extracted from Alg/HA hydrogel by dissolution in 55mM sodium citrate (Sigma) and 50mM EDTA solution (Merck, Darmstadt, Germany) for 5minutes. After centrifugation (320g, 5minutes), viability, phenotype and mRNA expression were analyzed. Only at 28days of culture were other scaffolds used for histological processing. WJ-MSC viability was also evaluated for two methods of scaffold construct: alginate beads and alginate cylinders (obtained by spraying method) at 3, 7 and 10days of culture.

Apoptosis and necrosis of cells were analyzed by flow cytometry using the Vybrant/Apoptosis

kit based on the AnnexinV/propidium iodide (PI) staining procedure (Invitrogen, Carlsbad, CA). Cells were suspended in 100L 1 Annexin-liant buffer with 2.5L Annexin V-Alexa 488 and 1L PI (100g/mL), for 15minutes at room temperature. After incubation, 200L 1 Annexin V buffer were added to each sample. Then, cells were analyzed by measuring fluorescence emission at 530nm and 575nm, respectively, for Alexa 488 (apoptotic cells) and PI (necrotic cells) with a Gallios flow cytometer (Beckman Coulter, Brea, CA, USA). Negative (unlabeled cells) and positive controls (apoptosis and necrosis) were performed (Fig.

). Apoptosis was induced by incubating anti-Fas mouse antibody (Enzo Life Sciences, Farmingdale, NY, USA) with the cells for 1hour. After washing, a second anti-mouse IgG3 antibody (BD, Franklin Lakes, NJ, USA) was incubated for 1hour with cells and, finally, cells were labeled only with Annexin V-Alexa 488. Cell necrosis was induced by adding Triton X-100 solution (Sigma) for 1minute before centrifugation (300g, 5minutes) and PI labeling. For all analyses, at least 5000 events were analyzed. Viable cells were Annexin V

and PI

.

Changes in MSC viability during scaffold culture. Cell viability was measured by flow cytometry at 3, 14 and 28days of culture of MSC embedded in Alg/HA hydrogel. Necrotic and apoptotic cells were labeled with propidium iodide and annexin VAlexa 488, respectively. a Positive controls for apoptotic and necrotic cells. b Cell viability was evaluated after spraying method of scaffold construct between BM-MSC and WJ-MSC. c WJ-MSC viability was evaluated for two methods of scaffold construct: alginate beads and alginate cylinders (obtained by spraying method) at 3, 7 and 10days of culture. The results are expressed as meanstandard error of the mean (n3). *p<0.05 and **p<0.01, day x vs day 3 for the same cell source (b) or method of scaffold construct (c). #p<0.05, cylinders vs beads for the same culture time. BM-MSC bone marrow-derived mesenchymal stromal/stem cells, WJ-MSC Whartons ielly-derived mesenchymal stromal/stem cells

Phenotypic analysis of MSC was performed during monolayer expansion (prior to encapsulation in the hydrogel) and throughout scaffold culture. Briefly, to perform phenotypic analysis MSC were incubated with fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated mouse anti-human antibodies CD34-PE, CD45-FITC, HLA-DR-FITC, CD44-FITC, CD73-PE, CD90-FITC, CD105-PE and CD166-PE (Beckman Coulter, Brea, CA, USA) for 30minutes at room temperature. Negative and isotype (FITC and PE) controls were performed.
After immunofluorescence staining, for each sample 10,000 events were counted by Gallios flow cytometer (Beckman Coulter, Brea, CA, USA).

MSC were rinsed with phosphate-buffered saline three times to remove residual alginate. Total RNA was extracted by RNeasy Plus mini kit (Qiagen, Hilden, Germany) according to the manufacturers instructions. RNA yield was evaluated by spectrophotometry and RNA quality was analyzed by electrophoresis through a 1% agarose gel. RNA was then reverse-transcripted to cDNA using iScript cDNA Synthesis Kit (Bio-rad, Hercules, CA, USA). Quantitative polymerase chain reaction (PCR) was performed using iTaq Universal SYBR Green Supermix (Bio-rad) and a Light Cycler system (Roche Diagnostics, Basel, Switzerland) during 45cycles to quantitatively analyze gene expression. Values were normalized to expression of RP29 mRNA. Table

lists the specific primers used.

List of polymerase chain reaction primers used for the present study

RP29

AAGATGGGTCACCAGCAGCTCTACTG

AGACGCGGCAAGAGCGAGAA

60

Sox9

GAGCAGACGCACATCTC

CCTGGGATTGCCCCGA

55

Aggrecan

TCGAGGACAGCGAGGCC

TCGAGGGTGTAGCGTGTAGAGA

62

COMP

ACAATGACGGAGTCCCTGAC

TCTGCATCAAAGTCGTCCTG

60

Type IIa collagen

GCAGGATGGGCAGAGGTAT

ATCTCAGGGCTGAGGCAGT

60

Total II collagen

ATGACAATCTGGCTCCCAAC

GAACCTGCTATTGCCCTCTG

55

Type X collagen

GCTAAGGGTGAAAGGGGTTC

CTCCAGGATCACCTTTTGGA

60

Runx2

CCCGTGGCCTTCAAGGT

CGTTACCCGCCATGACAGTA

56

PPAR

TTCAGAAATGCCTTGCAGTG

CCAACAGCTTCTCCTTCTCG

58

Matrix synthesis was evaluated by histology, immunofluorescence staining and immunohistochemistry. After 28days of chondrogenic differentiation, Alg/HA scaffolds were fixed in 4% paraformaldehyde (Sigma), 100mM sodium cacodylate (Sigma) and 10mM CaCl2 (Sigma) solution (pH7.4) for 4hours and then washed overnight in 100mM sodium cacodylate and 50mM BaCl2 (Sigma) buffer (pH7.4). The scaffolds were dehydrated, embedded in paraffin blocks, cut into 5m thick sections and mounted onto glass slides.

For histological analysis, total collagen and proteoglycans were stained by Sirius red and Alcian Blue, respectively, and observed by light microscopy (DMD 108, Leica, Wetzlar, Germany).

For immunofluorescence staining, hydrogel sections were deparaffinized and permeabilized with 0.1% Triton X-100 (Sigma) for 20minutes and then blocked with 0.5% bovine serum albumin (Sigma) in DMEM without phenol red (Gibco) for 15minutes at room temperature. Specimens were incubated for 45minutes with rabbit anti-human type I, II, or X collagen antibodies (1:50) (Merck, Darmstadt, Germany). After a washing step, samples were incubated for 45minutes with secondary antibody: a goat anti-rabbit IgG Alexa Fluor 488 (1:50) (Invitrogen, Carlsbad, CA, USA). Negative and isotype controls were also performed. Immunofluorescence labeling was detected using fluorescence microscopy (DMI 3000B, Leica, Wetzlar, Germany).

Immunohistochemistry with antibodies for collagen type type I, II and X was performed according to LSAB+kit (HRP, Dako) based on avidin-biotin techniques. Primary monoclonal antibodies collagen I (T59103R, Biodesign) and collagen II (6B3, Labvision) were used at the dilution of 1/100 and collagen X (Ab49945, Abcam) was used at the dilution of 1/1000. Paraffin-embedded tissue sections of 5m were deparaffinized through a series of alcohols and treated with pepsin (0.4%w/v in 0.01M HCl, pH2.0, Sigma) for 30minutes at room temperature. Slides were then incubated with hydrogen peroxide block solution for 5minutes to block endogenous peroxidase. After washing, 2% bovine serum albumin solution was applied for 10minutes at room temperature to block the unspecific epitope. The primary antibody was added to each slide and slides were incubated at room temperature in a humidified chamber for 1hour. Subsequently, the samples were incubated with a biotinylated link secondary antibody for 45minutes at room temperature. Peroxidase-labeled steptavidin was applied at room temperature for 30minutes. Substrate-chromogen solution was prepared with diaminobenzidine (DAB, LSAB+kit, Dako) and incubated to the specimen and monitored under a microscope for the desired stain intensity. Control groups for immunohistochemical analysis were performed under identical conditions on human cartilage for positive control or without primary antibodies for negative control. Finally the sections were counterstained with hematoxylin at 1/5 for 1minute (RAL, France) and mounted with Eukit resin.

Statistical tests and graphic representations were performed using graphPad Prism 5 software (GraphPad, San Diego, CA, USA). All the data are presented as meanstandard error of the mean of independent experiments with cells from different donors that were pooled. Significant statistical differences were calculated using one- or two-way analysis of variance. A p-value less than 0.05 was considered significant for the analyses of variance. If significance existed, a post-hoc analysis was performed using the Bonferonni post-tests to evaluate significance for all experiments.

Cell viability, apoptosis and necrosis were analyzed 3, 14 and 28days after spraying method of scaffold construct and data were compared to BM-MSC (Fig.2b). After 3days of culture, WJ-MSC viability was 584%. From 14days, viability significantly increased (p<0.05) and became greater than 80% until 28days. Meanwhile, apoptosis and necrosis decreased from 14 up to 28days (data not shown). No significant difference was observed between WJ-MSC and BM-MSC. To understand WJ-MSC behavior in early culture, the same parameters were evaluated using two methods of scaffold construct, alginate beads and alginate cylinders obtained by spraying method, between 3 and 10days after build-up (Fig.2c). The results indicated clearly that at the third day of culture the viability of sprayed cells was significantly lower than in cells embedded in alginate beads (p<0.05). At the same time, cell apoptosis was significantly higher in cylinders compared to cells seeded in beads (p<0.05) (data not shown).

Flow cytometry showed that, regardless of the
time of culture or the cell source, MSC were negative for the hematopoietic markers CD34, CD45 and HLA-DR (Fig.

). Less than 5% of cells expressed these surface markers. WJ-MSC from the monolayer to the end of 3D culture variably expressed mesenchymal markers such as CD44, CD73, CD90, CD105 and CD166 (Fig.

). During monolayer expansion, the proportion of CD44

, CD73

and CD105

cells were significantly higher (at least 20%) in WJ-MSC compared to BM-MSC (

cells remained relatively constant. From 14days, positive expression for mesenchymal markers seemed to be less for WJ-MSC than for BM-MSC, especially for CD90 and CD166 which were significantly reduced (

Immunophenotypic analysis of MSC by flow cytometry during monolayer expansion (prior to encapsulation in the hydrogel) and throughout scaffold culture. a Hematopoietic markers and major histocompatibility complex class II molecule. b Mesenchymal surface markers. For mesenchymal surface markers, the results are shown as percentages of positive cells. All results are expressed as meanstandard error of the mean (n3). *p<0.05, **p<0.01 and ***p<0.001, day x vs day 0 (monolayer) for the same cell source. #p<0.05, ##p<0.01 and ###p<0.001, WJ-MSC vs BM-MSC for the same culture time. BM-MSC bone marrow-derived mesenchymal stromal/stem cells, WJ-MSC Whartons jelly-derived mesenchymal stromal/stem cells

Relative expression of specific cartilage-related genes was evaluated by quantitative RT-PCR during chondrogenic differentiation. Relative expression of other mesodermic lineage markers such as Runx2 or PPAR was also reported (Fig.

). While aggrecan and type IIa collagen expression seemed to increase during 3D culture of WJ-MSC, Sox9, COMP and total type II collagen expression by WJ-MSC were significantly higher compared to early stages of chondrogenesis (

Relative expression of specific cartilage-related genes evaluated by quantitative RT-PCR during 28days of chondrogenic induction. All results are expressed as meanstandard error of the mean (n3). *p<0.05, **p<0.01 and ***p<0.001, day x vs day 3 for a same cell source. ###p<0.001, WJ-MSC vs BM-MSC for a same culture time. BM-MSC bone marrow-derived mesenchymal stromal/stem cells, COMP cartilage oligomeric matrix protein, COL collagen, WJ-MSC Whartons jelly-derived mesenchymal stromal/stem cells

Original post:
Stem Cell Research & Therapy - stemcellres.biomedcentral.com